Basic Information

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 6 0.00082 0.1 14.6 0.9 2 23 75 95 74 95 0.97

2 6 1.5e-06 0.00019 23.2 0.2 2 23 101 123 100 123 0.97

3 6 4.1e-05 0.0051 18.7 4.7 1 23 129 152 129 152 0.97

4 6 4.4e-06 0.00054 21.8 0.1 1 23 158 180 158 180 0.98

5 6 3.8e-06 0.00047 22.0 0.1 1 23 186 208 186 208 0.98

6 6 0.00091 0.11 14.5 0.1 6 23 218 235 217 235 0.99

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	6	0.00082	0.1	14.6	0.9	2	23	75	95	74	95	0.97
2	6	1.5e-06	0.00019	23.2	0.2	2	23	101	123	100	123	0.97
3	6	4.1e-05	0.0051	18.7	4.7	1	23	129	152	129	152	0.97
4	6	4.4e-06	0.00054	21.8	0.1	1	23	158	180	158	180	0.98
5	6	3.8e-06	0.00047	22.0	0.1	1	23	186	208	186	208	0.98
6	6	0.00091	0.11	14.5	0.1	6	23	218	235	217	235	0.99

Coding Sequence: ATGTCGCTTTTCTCGAAAACGCTCGGTTCGTACAACTTTTACATTGAAAGTATTCGCGCCCTTTTTTTAAGTCTTGTAAAGAATAGTGAAACAGTTCGTAAACGGCTTTTCCCAAACCTTTACAGAGAAGAGAAACCAAAGATAGAACTGGCGACAGAGGTGACAATAAAAAGCGAAGAATCCTCTCCACCGGACATACAACACATCGACAAACGCCACGTCACCTGCACGATATGTCGGAAAGAGCTGAGAAAAGAATCATGGCGGCGGCATATGAGGATACACAAAGACGAAAAGAAATACTGCGACGTGTGCGGACTTGGGTTTACGGACAGCGGGAATCTCGCGCGACACAAACGCACATTACACGCACAAAACCGCACGCACAAATGTACAATCTGTAATAGCACATTCTCAAGACGCGGCTATTTGCAATACCACATGAAGTACACTCATTCGAATATTCGAGAATTTGTCTGTGACGTTTGTGGGAAAGCGTCGAAAACTAAAGCGGGGTTGAAAATGCATATGGCGAGTCACGATAGAGTGTTTAGGTTTAAGTGTATGGATTGCGGGGCGGAGTTCAAGAGGAGGGGGGAGCTGCGCGCGCATGTGAGCGTGCACACGGGCGAGAGGGCGCACGTGTGTGCGTGCGGCAAAGCGTTCCGGTTGCGGGCTCAGTTGACCTTGCATGCGCGCACGCATTTAAACATATTATGA
Protein Sequence: MSLFSKTLGSYNFYIESIRALFLSLVKNSETVRKRLFPNLYREEKPKIELATEVTIKSEESSPPDIQHIDKRHVTCTICRKELRKESWRRHMRIHKDEKKYCDVCGLGFTDSGNLARHKRTLHAQNRTHKCTICNSTFSRRGYLQYHMKYTHSNIREFVCDVCGKASKTKAGLKMHMASHDRVFRFKCMDCGAEFKRRGELRAHVSVHTGERAHVCACGKAFRLRAQLTLHARTHLNIL*

Sequence clustering based on sequence similarity using MMseqs2