Basic Information

Insect: Drosophila colorata
Gene Symbol: -
Assembly: GCA_035041545.1
Location: JAWNLD010000490.1:6282401-6283294[+]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 7 1.4e-05 0.00089 19.5 0.4 3 23 79 99 78 99 0.98

2 7 6.7e-06 0.00044 20.5 0.4 1 23 105 127 105 127 0.96

3 7 1e-05 0.00066 20.0 0.5 1 23 133 155 133 155 0.96

4 7 4.8 3.1e+02 2.1 1.5 1 23 161 186 161 186 0.87

5 7 8.5e-05 0.0055 17.1 1.5 1 23 213 235 213 235 0.99

6 7 2.4e-05 0.0015 18.8 0.5 2 23 242 265 241 265 0.88

7 7 0.00011 0.0074 16.6 0.9 1 23 271 293 271 293 0.98

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	7	1.4e-05	0.00089	19.5	0.4	3	23	79	99	78	99	0.98
2	7	6.7e-06	0.00044	20.5	0.4	1	23	105	127	105	127	0.96
3	7	1e-05	0.00066	20.0	0.5	1	23	133	155	133	155	0.96
4	7	4.8	3.1e+02	2.1	1.5	1	23	161	186	161	186	0.87
5	7	8.5e-05	0.0055	17.1	1.5	1	23	213	235	213	235	0.99
6	7	2.4e-05	0.0015	18.8	0.5	2	23	242	265	241	265	0.88
7	7	0.00011	0.0074	16.6	0.9	1	23	271	293	271	293	0.98

Sequence Information

Coding Sequence: ATGCGCCAGCCGGAGGAGCTGGATGATGGGTACGCCGCCTGCCTGACCGAGGATGTGCGTCTGTTTGCCCAGCTGGACGATCTGGAGGATGAGCCCGACTCGCAGCTAATCCAGGTGAGTGCCGTGTGGAATGCTGGCTCAGCCGCCCGCTCATGCTCCAGCTCTTTGCAGGCGCCCAAGCCGAGGCCGAGATCGAGGCGAGCTGCGCCCGTGCCGCGGGAGGCGCGCAACCTGTGCGATGTGTGCGAACGGCGCTTCAGCGACGCCTACAGCCTGCGCATCCACAAGATGACGCACACGGACGAGCGGCCGCACGTATGCGCCGAGTGCGGCAAGGGCTTCCGCCAGCTGAGCAAGCTGCGCATCCACGCCGTGACCCACACGGATCAGCGGCCGCACGCGTGCGATATCTGCGGCAAGGGATTCCGGTTCGCCAACTACTTGGCGGTGCACCGGCGACTGCACACGGGCGAGAAGCCCTACGCGTGCACGGTATCCGGCTGCAGTCTCTCCTTCCACTCCATTCACGCGCGCCGCATGCACGCGAAGCTCCAACATGCCACTGCCACAGAGATCAACCCAGAGGAGGATGTGGAACCGCAGCGAGAGGAGACTTCGTCGATGGCATCGCTCAGCTACACCTGTCCCGTGTGCGCCCGCGTTCTCACTGATCAGTGCTACCTCAACACGCACCTGAAGCGCCACTTCAACCAGCGCGACTTCGCCTGCGCGCAGCCGGGCTGCGGCAAGCGCTTCTTCAGCTCCTCGGAGCTGAACCACCATCAGATCGCGCACACGCGCCTGCGTCCCTTCCGCTGCGCGCTGTGCGGCGCCCGCTTCCTGCGCAACTCGAATTACAAGCAGCACCTGAAGGTGCACAAGGGCGACGATTGA
Protein Sequence: MRQPEELDDGYAACLTEDVRLFAQLDDLEDEPDSQLIQVSAVWNAGSAARSCSSSLQAPKPRPRSRRAAPVPREARNLCDVCERRFSDAYSLRIHKMTHTDERPHVCAECGKGFRQLSKLRIHAVTHTDQRPHACDICGKGFRFANYLAVHRRLHTGEKPYACTVSGCSLSFHSIHARRMHAKLQHATATEINPEEDVEPQREETSSMASLSYTCPVCARVLTDQCYLNTHLKRHFNQRDFACAQPGCGKRFFSSSELNHHQIAHTRLRPFRCALCGARFLRNSNYKQHLKVHKGDD

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: -
90% Identity: -
80% Identity: -