Basic Information

Insect: Collessia kirishimana
Gene Symbol: ZNF217
Assembly: GCA_035078785.1
Location: JAWNPV010037793.1:1-932[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 10 9.9e-06 0.00098 20.3 1.3 1 23 12 34 12 34 0.99

2 10 0.00028 0.027 15.7 2.7 1 23 40 63 40 63 0.96

3 10 0.15 15 7.1 3.8 1 20 69 88 69 91 0.95

4 10 0.0036 0.36 12.2 1.7 1 23 97 119 97 119 0.97

5 10 1.7e-05 0.0016 19.5 1.2 1 23 125 147 125 147 0.98

6 10 0.00012 0.012 16.8 0.9 1 23 155 178 155 178 0.95

7 10 1.3e-05 0.0013 19.9 0.5 2 23 185 206 184 206 0.97

8 10 5.4e-05 0.0053 18.0 1.7 1 23 212 234 212 234 0.98

9 10 1.7e-05 0.0017 19.5 0.5 1 23 240 263 240 263 0.95

10 10 1.7e-07 1.6e-05 25.9 4.8 1 23 277 299 277 299 0.97

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	10	9.9e-06	0.00098	20.3	1.3	1	23	12	34	12	34	0.99
2	10	0.00028	0.027	15.7	2.7	1	23	40	63	40	63	0.96
3	10	0.15	15	7.1	3.8	1	20	69	88	69	91	0.95
4	10	0.0036	0.36	12.2	1.7	1	23	97	119	97	119	0.97
5	10	1.7e-05	0.0016	19.5	1.2	1	23	125	147	125	147	0.98
6	10	0.00012	0.012	16.8	0.9	1	23	155	178	155	178	0.95
7	10	1.3e-05	0.0013	19.9	0.5	2	23	185	206	184	206	0.97
8	10	5.4e-05	0.0053	18.0	1.7	1	23	212	234	212	234	0.98
9	10	1.7e-05	0.0017	19.5	0.5	1	23	240	263	240	263	0.95
10	10	1.7e-07	1.6e-05	25.9	4.8	1	23	277	299	277	299	0.97

Sequence Information

Coding Sequence: CGTCACCTGCGCACCCATGACTCTGACATGTCCTTCAAGTGCTCAATCTGTGAACGCGGTTTCAAGACACACGTGGGTCTGGTCAACCATCTGAACACCCACTTGGGCCACAAGCCGCACAAATGCCGCTCCTGTGATAGTGCATTCACAACCAGCGGTGAGCTGATCCGGCATACACGGTACAAGCATACCAAGGAGAAGCCACACAAGTGCACTGAGTGCAGCTATGCCAGCGTCGAACTGACCAAGCTACGTCGTCACATGACCTGTCACACGGGCGAGCGTCCATACCAGTGTCCACACTGCACTTACGCCTCGCAGGACATGTTCAAGCTGAAACGACATTTGGTCATCCACACGGGTGAACGGAAATACCAATGCGACATCTGTAAGTCCCGTTTCACGCAGTCCAATTCGCTGAAGGCCCACAAGCTCATACACAGCGTAGCGGATAAGCCAGCCTTTCAGTGCTCGCTCTGTCCCACGACGTGCGGCAGGAAGGCTGATCTCCGCACCCACATAGCCAACATGCACACTGCGACCGATCCGTTGCCCTGCAAGCGCTGCGGGCAAGAATTCCCCGATCGCTACCAATACAAGCTGCACATTAAGACCCACGAAGGTGAGAAATGCTACCGTTGTAATCTTTGCGACTATGCTTCGGTCTCGCAGCGGCATCTCAACTCTCACATGTATATCCACACCGATGAGAAACCGTTCATCTGCGACTTGTGTCCACAAACATTCAGACAAAAACAGCTTCTGGTTCGGCACAGAAATTTGGTTCACAATGAAGATTATAAACCACCAGAGCCGCGCGAGAAGCGACACTCCTGTCCGAACTGTGATCGCGTCTTTAGCCACAAAGGCCATCTCATACGCCACATGGAAACGCACGACAAGTCCATGAATTCGCGCGCAGAGAAATTGAA
Protein Sequence: RHLRTHDSDMSFKCSICERGFKTHVGLVNHLNTHLGHKPHKCRSCDSAFTTSGELIRHTRYKHTKEKPHKCTECSYASVELTKLRRHMTCHTGERPYQCPHCTYASQDMFKLKRHLVIHTGERKYQCDICKSRFTQSNSLKAHKLIHSVADKPAFQCSLCPTTCGRKADLRTHIANMHTATDPLPCKRCGQEFPDRYQYKLHIKTHEGEKCYRCNLCDYASVSQRHLNSHMYIHTDEKPFICDLCPQTFRQKQLLVRHRNLVHNEDYKPPEPREKRHSCPNCDRVFSHKGHLIRHMETHDKSMNSRAEKL

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: -
90% Identity: -
80% Identity: -