Basic Information

Insect: Blastobasis adustella
Gene Symbol: -
Assembly: GCA_907269095.1
Location: OU026118.1:10464228-10465649[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 15 0.00082 0.078 14.3 0.1 1 23 21 44 21 44 0.95

2 15 1.8e-06 0.00017 22.7 2.7 1 23 54 77 54 77 0.97

3 15 6.3e-06 0.0006 21.0 0.4 3 23 85 106 85 106 0.97

4 15 4e-06 0.00038 21.6 0.3 1 23 112 134 112 134 0.98

5 15 0.0024 0.23 12.9 0.7 3 23 142 162 140 162 0.94

6 15 5.7e-07 5.4e-05 24.3 0.2 1 23 168 191 168 191 0.97

7 15 5.5e-07 5.2e-05 24.3 2.6 1 23 201 224 201 224 0.97

8 15 0.00013 0.012 16.9 0.7 3 23 232 253 230 253 0.97

9 15 0.00019 0.018 16.3 0.1 1 23 259 281 259 281 0.98

10 15 7.5e-06 0.00071 20.8 3.5 1 23 289 312 289 312 0.97

11 15 4.8e-05 0.0046 18.2 0.1 3 23 320 340 318 340 0.98

12 15 1.5e-05 0.0014 19.8 3.0 1 23 346 369 346 369 0.96

13 15 5.2e-05 0.0049 18.1 4.2 1 23 375 398 375 398 0.96

14 15 3.4e-06 0.00032 21.8 0.4 1 23 404 426 404 426 0.97

15 15 0.0013 0.13 13.7 0.1 3 23 434 455 432 455 0.96

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	15	0.00082	0.078	14.3	0.1	1	23	21	44	21	44	0.95
2	15	1.8e-06	0.00017	22.7	2.7	1	23	54	77	54	77	0.97
3	15	6.3e-06	0.0006	21.0	0.4	3	23	85	106	85	106	0.97
4	15	4e-06	0.00038	21.6	0.3	1	23	112	134	112	134	0.98
5	15	0.0024	0.23	12.9	0.7	3	23	142	162	140	162	0.94
6	15	5.7e-07	5.4e-05	24.3	0.2	1	23	168	191	168	191	0.97
7	15	5.5e-07	5.2e-05	24.3	2.6	1	23	201	224	201	224	0.97
8	15	0.00013	0.012	16.9	0.7	3	23	232	253	230	253	0.97
9	15	0.00019	0.018	16.3	0.1	1	23	259	281	259	281	0.98
10	15	7.5e-06	0.00071	20.8	3.5	1	23	289	312	289	312	0.97
11	15	4.8e-05	0.0046	18.2	0.1	3	23	320	340	318	340	0.98
12	15	1.5e-05	0.0014	19.8	3.0	1	23	346	369	346	369	0.96
13	15	5.2e-05	0.0049	18.1	4.2	1	23	375	398	375	398	0.96
14	15	3.4e-06	0.00032	21.8	0.4	1	23	404	426	404	426	0.97
15	15	0.0013	0.13	13.7	0.1	3	23	434	455	432	455	0.96

Sequence Information

Coding Sequence: ATGTTCAAGACTAGGGGTGCTATCCGGGCCCATTTTGTGGTACACAGCAAGATTCGGCCTTATCCCTGCGAGCAGTGTGGCAAGGCCTTCAAAGCGGTGCGAGAGTTATATGTTCACAAAAAATGGGTACATATGGCAGTAGATAGCGATGTGCTACGTCATACTTGTGAACAATGTGGCAAAACCTACAAACGACTTGACAGCTTGAAGGCTCATAAACGACGGGGGCATACAAAAAAACTACCCATTGGTTGTGACACCTGCGGAAAGGTGTTCAAGACTAGAGGCGCTCTCCAAATCCATACTAGGCAAATTCACAGCGAGGCGCGGCCTTATCCTTGCTTGCAGTGTGGTATGGTCTTCAAATTTCCGCGCAATTTGAAGATACACCAACAGGTGCATACAGATAGACGTCGCTTTGGTTGTGACACCTGTGGCAAGATGTTCAAGACTAGACACGCTATCCTGGTCCACTTTGCGGTGCACAGCAACACGCGGCGTTATCCCTGCGAGCAGTGCGGCAAGAACTTTAAATCGGCGCCTGAGTTAAGGGCTCACCAAAAACGGGTACATATGGCGGTAGATAGCGATGCACTACCTCATACCTGTGAACAATGTGGCAAAACCTTTAAACAACTTGACAGCTTAAAGGCTCATAAACGACGGGGGCATACAGACATACGTCCCTTCGGTTGTGACACCTGCGGCAAGATGTTCAAGACAACGCGAGAAGTCCAGGTCCATACTAGGCGAGTACACAGCGAGGCGCGGCCTTATTCCTGCGCGCTGTGCGGTAAGGCCTTCAAATTGCCGGGCATTTTAAAAAAACACCAACAGGTGCATATAGATAGCGATGCGCTACTACATTCCTGCGAACAATGTGGCAAAACCTTCAGAAAATTTGACAGCTTAAAGGCTCATAAACGACGGGGGCATACAGACATACGTCCCTTCGGTTGTGACACCTGTGGCAAGGCTTTCAAGACTCGGGGCGCTATCCAGGTCCATATTGCAACACACAGCGATGCACTACCTCATACCTGCGATCAATGCGGCAAAACCTTCACACAACTTGACCGCTTGAAGGCTCATAAACAACGGATGCATATAGACATACGTCCCTTCTGTTGTGACGCTTGTGGCAAGATGTTTAAGACAAAGAGAGATATGCAGAAACATACTAGGCGAGTACACAGCGAAGCGGAGCCTTATCCGTGCGCGCAGTGCGGCAAGGCTTTCAAATTGCGGTACAATCTAAAGAAACACGAACTTGTCCATACAGGTGAGCGTCCCTTCGGCTGTGACGTCTGCGGAAAAACGTACCTGAGCAAGGGCGCTCTCCAGACACACATAAACCTTTCACATGAACCGATGGGGGTCCAGCGAGCGAAACCAATTGGTGTCGGCCGCATATTAGCGTAA
Protein Sequence: MFKTRGAIRAHFVVHSKIRPYPCEQCGKAFKAVRELYVHKKWVHMAVDSDVLRHTCEQCGKTYKRLDSLKAHKRRGHTKKLPIGCDTCGKVFKTRGALQIHTRQIHSEARPYPCLQCGMVFKFPRNLKIHQQVHTDRRRFGCDTCGKMFKTRHAILVHFAVHSNTRRYPCEQCGKNFKSAPELRAHQKRVHMAVDSDALPHTCEQCGKTFKQLDSLKAHKRRGHTDIRPFGCDTCGKMFKTTREVQVHTRRVHSEARPYSCALCGKAFKLPGILKKHQQVHIDSDALLHSCEQCGKTFRKFDSLKAHKRRGHTDIRPFGCDTCGKAFKTRGAIQVHIATHSDALPHTCDQCGKTFTQLDRLKAHKQRMHIDIRPFCCDACGKMFKTKRDMQKHTRRVHSEAEPYPCAQCGKAFKLRYNLKKHELVHTGERPFGCDVCGKTYLSKGALQTHINLSHEPMGVQRAKPIGVGRILA

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: -
90% Identity: -
80% Identity: -