Basic Information

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 6 0.28 32 6.9 1.1 1 23 83 105 83 105 0.96

2 6 5e-06 0.00056 21.8 2.5 2 23 111 132 110 132 0.98

3 6 2.8e-05 0.0032 19.5 0.2 1 23 138 160 138 160 0.97

4 6 1e-06 0.00011 24.0 2.7 1 23 165 187 165 187 0.98

5 6 1.6e-06 0.00018 23.4 2.1 1 23 193 215 193 215 0.98

6 6 0.00011 0.012 17.6 4.7 1 23 221 244 221 244 0.96

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	6	0.28	32	6.9	1.1	1	23	83	105	83	105	0.96
2	6	5e-06	0.00056	21.8	2.5	2	23	111	132	110	132	0.98
3	6	2.8e-05	0.0032	19.5	0.2	1	23	138	160	138	160	0.97
4	6	1e-06	0.00011	24.0	2.7	1	23	165	187	165	187	0.98
5	6	1.6e-06	0.00018	23.4	2.1	1	23	193	215	193	215	0.98
6	6	0.00011	0.012	17.6	4.7	1	23	221	244	221	244	0.96

Coding Sequence: ATGAAGAATAAAAAAGTAAGCAAACAGAAGACAGGCTGCCAGCCAACTTCTTACGATACTTTATACGCCGACCATGAGCTCACAGAAGATATGGCGATAGGTCCTGTCGTCGTTCAGCGTCCGCGTCCCAGCCTCAGGCTTATATTTCAAAGTCCTGAAAAACACATTGTGAAATCTCATCAAACCAAAGAGTCCAAAGCAAATGAATCCAAGTGTAAAATATGCCAATCTGGAGGTGAAAAACACTATACCTGTGCTCACTGTGAAGAACACGTCTATTCCAAACTAAGCATTATAGCACACTTACAAGACCATGCTAAACGTCCCGTAAAATGCACTTTATGCTCAAAAACCTTCACATCTCGCAAGTTCTTACAACAACATATGATAACCCATTCGGATGAGCGAAAGTTTGCCTGCAACGTTTGCAACCGAGCGTACAAAACCATTTCTTCACTGGATAATCACATGCTCATACATCAACCGAAGCGATTCCAATGCCAATACTGTCAGAAAAGGTTTACGCAGAAGATTCAATTACAAGTCCACGAGAGATCCCACACCGGTGAGAAGCCTTACGTATGTAGATATTGTTTCAAAGAATTTACGCAGCAGACGTCACTGAAGAACCACATGTTGATCCACAGCAACGTCAAACCCTATTGCTGCTCGTTTTGCGAAAAGAAGTTCCGGCAAGTTAGTAACCTCAAACAGCATGTGTTGAAGAATCATCCAAACAAAGATGCAAATTCTAATAAAAAGCGTTCCTTTAGTTATAAGGCTTGA
Protein Sequence: MKNKKVSKQKTGCQPTSYDTLYADHELTEDMAIGPVVVQRPRPSLRLIFQSPEKHIVKSHQTKESKANESKCKICQSGGEKHYTCAHCEEHVYSKLSIIAHLQDHAKRPVKCTLCSKTFTSRKFLQQHMITHSDERKFACNVCNRAYKTISSLDNHMLIHQPKRFQCQYCQKRFTQKIQLQVHERSHTGEKPYVCRYCFKEFTQQTSLKNHMLIHSNVKPYCCSFCEKKFRQVSNLKQHVLKNHPNKDANSNKKRSFSYKA*

Sequence clustering based on sequence similarity using MMseqs2