Basic Information

Transcription Factor Domain

TF Family: Runt
Domain: Runt domain
PFAM: PF00853
TF Group: Beta-Scaffold Factors
Description: The AML1 gene is rearranged by the t(8;21) translocation in acute myeloid leukemia [1]. The gene is highly similar to the Drosophila melanogaster segmentation gene runt and to the mouse transcription factor PEBP2 alpha subunit gene [1]. The region of shared similarity, known as the Runt domain, is responsible for DNA-binding and protein-protein interaction.In addition to the highly-conserved Runt domain, the AML-1 gene product carries a putative ATP-binding site (GRSGRGKS), and has a C-terminal region rich in proline and serine residues. The protein (known as acute myeloid leukemia 1 protein, oncogene AML-1, core-binding factor (CBF), alpha-B subunit, etc.) binds to the core site, 5'-pygpyggt-3', of a number of enhancers and promoters.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 2 9.8e-12 7.3e-08 33.1 0.1 90 118 43 71 40 73 0.94

2 2 8.5e-16 6.3e-12 46.2 0.1 95 129 74 108 72 108 0.96

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	2	9.8e-12	7.3e-08	33.1	0.1	90	118	43	71	40	73	0.94
2	2	8.5e-16	6.3e-12	46.2	0.1	95	129	74	108	72	108	0.96

Coding Sequence: ATGAGTGAGTCAAGTCGAGGTGTCGTGATCGCGCGGACGGTGGCGGCCCGCGGCAGGCACCGGCTCACTCTCTACCGATCCGAACAATTAGATTTGCTGCTAATGTGGATTACGCAAGGAGTTTACAGTTGGAAAGGCAAATCCTTCACGCTGACCATCACGGTATCGACCACCCCCCCGCAGGTGACGACGTACAACAAAGCCATCAAGATTAACTCATCCTTCACGCTCACTATCACGTTATGGACCACGCCACCGCAGGTGACGACGTACAACAAGGCCATCAAAGTGACGGCGGACGGGCCCCGGGAACCTCGCTCCAAAACCAGTTAG
Protein Sequence: MSESSRGVVIARTVAARGRHRLTLYRSEQLDLLLMWITQGVYSWKGKSFTLTITVSTTPPQVTTYNKAIKINSSFTLTITLWTTPPQVTTYNKAIKVTADGPREPRSKTS

Sequence clustering based on sequence similarity using MMseqs2