Basic Information

Insect: Anopheles bellator
Gene Symbol: -
Assembly: GCA_943735745.2
Location: OX030927.2:11701346-11702395[+]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 8 0.68 39 4.7 9.3 2 23 87 108 86 109 0.94

2 8 0.016 0.94 9.8 0.5 2 23 132 153 131 153 0.96

3 8 0.00058 0.034 14.3 8.4 1 23 166 188 166 188 0.98

4 8 0.00015 0.0086 16.2 1.8 1 23 194 217 194 217 0.95

5 8 4.6e-05 0.0026 17.8 0.2 1 23 223 246 223 246 0.96

6 8 4.9e-06 0.00028 20.8 3.1 1 23 265 287 265 287 0.98

7 8 6e-05 0.0034 17.4 0.1 3 23 295 315 293 315 0.97

8 8 0.005 0.29 11.4 0.1 1 23 321 344 321 344 0.96

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	8	0.68	39	4.7	9.3	2	23	87	108	86	109	0.94
2	8	0.016	0.94	9.8	0.5	2	23	132	153	131	153	0.96
3	8	0.00058	0.034	14.3	8.4	1	23	166	188	166	188	0.98
4	8	0.00015	0.0086	16.2	1.8	1	23	194	217	194	217	0.95
5	8	4.6e-05	0.0026	17.8	0.2	1	23	223	246	223	246	0.96
6	8	4.9e-06	0.00028	20.8	3.1	1	23	265	287	265	287	0.98
7	8	6e-05	0.0034	17.4	0.1	3	23	295	315	293	315	0.97
8	8	0.005	0.29	11.4	0.1	1	23	321	344	321	344	0.96

Sequence Information

Coding Sequence: ATGTTCGCCGTACCGCCTACCTTCGATGTTGAAGATGATGTTTGCATGCTGCCACTGATCGGCGTGCACGATAGCGTTATCGCGAAAGAGGTCACCTTTGAGGGTGAGTACTTGCCGCCACCGGAGCTACCGTACGCGGACTTTGCGCTGCTCGACCTGCCGGAAAACCGGACACTCCCACAAAGGACACCGTTACGCAACGCCTGCCCGAAGCAACCGGAAGTCCTCGGAAAACACCGCGCCAATCCGGCGGCACTCCGTTGCGAACATTGCGCGCTTCGTTTCCAGTGCAGATCGCACTTGACCCGCCACCAATCGGTGCACCATCGAAAGGAACTGCGTACGTCTTTTGAGCAGCGATTAAGAGACGTTAATCAGCATTCGAAAAGATCCGTGTGCGACATATGCCTAACGACATTTCACGGTCCGGTCACCCTCGAATGGCACCGAAAGTTTCATCTGGAGGAACAAGAACCGATCGAAGCGGTCGACGCGTATACTTGTGATGTTTGCCGTAAACGCTGTACCAGCTCCAGCCATTTGCATCTCCACCGGAAGGTTCACTTGGAGCAGAAACCCTACGCCTGTGGCCACTGCGAGCGAAGATTCTCGTCTTCCGGCAACCGTCAGAAGCACGTGACGCGGGTTCATACGCACGAACGAAAGTATCGCTGTGGGGTGTGCGAAAAGGCGTTCATCTATCCACGCCAGCTGAAGCTGCACGGACAGCGGGAGCACCGATCGTGTGGCCAGTCCGTGGGTGTGACAGTAACGTGTGAAGAACAACGCACTTTTGAATGCTCGCAGTGCGCGAAGCGGTTCAAGCAAGCAACGCACCTACGGAATCATCTCCTGACGCACACCGGGATTCGAGCTTACGGGTGTGAGTTTTGTCCGAAACGATTTGCTATGGCCGGCGATCTACGGATACATCGGCGGATTCACACGAAGGAAAAACCGTTCCGCTGTGACCGGTGCCCGGCTGCGTTCATCATGGGCAAACAGTTAAACAAACACCGGGCAGTGGTACACGGAACGGCGAAGACTTAA
Protein Sequence: MFAVPPTFDVEDDVCMLPLIGVHDSVIAKEVTFEGEYLPPPELPYADFALLDLPENRTLPQRTPLRNACPKQPEVLGKHRANPAALRCEHCALRFQCRSHLTRHQSVHHRKELRTSFEQRLRDVNQHSKRSVCDICLTTFHGPVTLEWHRKFHLEEQEPIEAVDAYTCDVCRKRCTSSSHLHLHRKVHLEQKPYACGHCERRFSSSGNRQKHVTRVHTHERKYRCGVCEKAFIYPRQLKLHGQREHRSCGQSVGVTVTCEEQRTFECSQCAKRFKQATHLRNHLLTHTGIRAYGCEFCPKRFAMAGDLRIHRRIHTKEKPFRCDRCPAAFIMGKQLNKHRAVVHGTAKT

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_00097297;
90% Identity: iTF_00097297;
80% Identity: -